FHIR © HL7.org  |  Server Home  |  Health Intersections FHIR Server v1.0.304  |  FHIR Version 4.0.1  | User: ANONYMOUS (Unknown)  

Resource "sequence-complex-variant" Version "1" (MolecularSequence)

Tags:

XML or JSON representation . provenance for this resource

Generated Narrative with Details

id: sequence-complex-variant

identifier: ?? (OFFICIAL)

type: dna

coordinateSystem: 1

specimen: Molecular Specimen ID: MLD45-Z4-1234

device: 12 lead EKG Device Metric

performer: HL7

quantity: 25

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)watson128273724128273754

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*128273724128273736CTCATTGTCTCCATTGCATGCGTT3M1D4M6N2M

readCoverage: 1

Repositories

-TypeDatasetIdReadsetId
*otherEnsemblv1beta2

{
  "resourceType" : "MolecularSequence",
  "id" : "sequence-complex-variant",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2018-12-14T02:02:38.739Z"
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>id</b>: sequence-complex-variant</p><p><b>identifier</b>: ?? (OFFICIAL)</p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 1</p><p><b>specimen</b>: <a>Molecular Specimen ID: MLD45-Z4-1234</a></p><p><b>device</b>: 12 lead EKG Device Metric</p><p><b>performer</b>: <a>HL7</a></p><p><b>quantity</b>: 25</p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td>NC_000002.12 <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)</span></td><td>watson</td><td>128273724</td><td>128273754</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td><td><b>Cigar</b></td></tr><tr><td>*</td><td>128273724</td><td>128273736</td><td>CTCATTGT</td><td>CTCCATTGCATGCGTT</td><td>3M1D4M6N2M</td></tr></table><p><b>readCoverage</b>: 1</p><h3>Repositories</h3><table><tr><td>-</td><td><b>Type</b></td><td><b>DatasetId</b></td><td><b>ReadsetId</b></td></tr><tr><td>*</td><td>other</td><td>Ensembl</td><td>v1beta2</td></tr></table></div>"
  },
  "identifier" : [
    {
      "use" : "official"
    }
  ],
  "type" : "dna",
  "coordinateSystem" : 1,
  "specimen" : {
    "reference" : "Specimen/genetics-example1-somatic",
    "display" : "Molecular Specimen ID: MLD45-Z4-1234"
  },
  "device" : {
    "display" : "12 lead EKG Device Metric"
  },
  "performer" : {
    "reference" : "Organization/hl7",
    "display" : "HL7"
  },
  "quantity" : {
    "value" : 25
  },
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NC_000002.12"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 128273724,
    "windowEnd" : 128273754
  },
  "variant" : [
    {
      "start" : 128273724,
      "end" : 128273736,
      "observedAllele" : "CTCATTGT",
      "referenceAllele" : "CTCCATTGCATGCGTT",
      "cigar" : "3M1D4M6N2M"
    }
  ],
  "readCoverage" : 1,
  "repository" : [
    {
      "type" : "other",
      "datasetId" : "Ensembl",
      "readsetId" : "v1beta2"
    }
  ]
}